Review



plasmid ecfp tevs ypet addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc plasmid ecfp tevs ypet addgene
    Plasmid Ecfp Tevs Ypet Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+ecfp+tevs+ypet+addgene/ECFP-TevS-YPET+(Plasmid+%23100097)/pm41689807-289-60-62
    Average 94 stars, based on 3 article reviews
    plasmid ecfp tevs ypet addgene - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Liquid-liquid phase separation of EphB4 drives pulmonary hypertension via YAP activation.
    Article Snippet: To polymerize the mixtures, 6 μL of 10% w/v ammonium persulfate (Bio-Rad) and .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting ANXA2, Target sequence (5’to3’): GCAGGAAATTAACAGAGTCTA Beijing Tsingke Biotech N/A siRNA targeting Ywhae (Rat), Target sequence (5’to3’): ACGAAATGGTGGAATCAATGAAG Beijing Tsingke Biotech N/A siRNA targeting Anxa2 (Rat), Target sequence (5’to3’): CCGAGTGTATAAGGAAATGTACA Beijing Tsingke Biotech N/A Recombinant DNA Plasmid containing full-length EPHB4 (human) ZOMANBIO Cat#ZK50168 Plasmid containing Cry2 (CRY2olig-mCherry) Addgene Cat#60032 Plasmid pEGFP-N1 Miaoling Biology Cat#P0133 Plasmid ECFP-TevS-YPET Addgene Cat100097 Software and algorithms FlowJo TM version 10.8.1 BD https://www.flowjo.com/solutions/flowjo/downloads ImageJ ImageJ Software https://imagej.nih.gov/ij/ GraphPad Prism v9 GraphPad Software https://www.graphpad.com/ Cell Reports 45, 116992, February 24, 2026 19 3 μL of N, N, N9, N9-tetramethylethylenediamine (TEMED; Bio-Rad) were added into the above mixed hydrogel solution. .. A 50- 70 mm-thick gel was cast, and the thickness was confirmed through imaging of embedded fluorescent beads (Invitrogen) in the gel by confocal microscope.

    Recombinant:

    Article Title: Liquid-liquid phase separation of EphB4 drives pulmonary hypertension via YAP activation.
    Article Snippet: To polymerize the mixtures, 6 μL of 10% w/v ammonium persulfate (Bio-Rad) and .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting ANXA2, Target sequence (5’to3’): GCAGGAAATTAACAGAGTCTA Beijing Tsingke Biotech N/A siRNA targeting Ywhae (Rat), Target sequence (5’to3’): ACGAAATGGTGGAATCAATGAAG Beijing Tsingke Biotech N/A siRNA targeting Anxa2 (Rat), Target sequence (5’to3’): CCGAGTGTATAAGGAAATGTACA Beijing Tsingke Biotech N/A Recombinant DNA Plasmid containing full-length EPHB4 (human) ZOMANBIO Cat#ZK50168 Plasmid containing Cry2 (CRY2olig-mCherry) Addgene Cat#60032 Plasmid pEGFP-N1 Miaoling Biology Cat#P0133 Plasmid ECFP-TevS-YPET Addgene Cat100097 Software and algorithms FlowJo TM version 10.8.1 BD https://www.flowjo.com/solutions/flowjo/downloads ImageJ ImageJ Software https://imagej.nih.gov/ij/ GraphPad Prism v9 GraphPad Software https://www.graphpad.com/ Cell Reports 45, 116992, February 24, 2026 19 3 μL of N, N, N9, N9-tetramethylethylenediamine (TEMED; Bio-Rad) were added into the above mixed hydrogel solution. .. A 50- 70 mm-thick gel was cast, and the thickness was confirmed through imaging of embedded fluorescent beads (Invitrogen) in the gel by confocal microscope.

    Plasmid Preparation:

    Article Title: Liquid-liquid phase separation of EphB4 drives pulmonary hypertension via YAP activation.
    Article Snippet: To polymerize the mixtures, 6 μL of 10% w/v ammonium persulfate (Bio-Rad) and .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting ANXA2, Target sequence (5’to3’): GCAGGAAATTAACAGAGTCTA Beijing Tsingke Biotech N/A siRNA targeting Ywhae (Rat), Target sequence (5’to3’): ACGAAATGGTGGAATCAATGAAG Beijing Tsingke Biotech N/A siRNA targeting Anxa2 (Rat), Target sequence (5’to3’): CCGAGTGTATAAGGAAATGTACA Beijing Tsingke Biotech N/A Recombinant DNA Plasmid containing full-length EPHB4 (human) ZOMANBIO Cat#ZK50168 Plasmid containing Cry2 (CRY2olig-mCherry) Addgene Cat#60032 Plasmid pEGFP-N1 Miaoling Biology Cat#P0133 Plasmid ECFP-TevS-YPET Addgene Cat100097 Software and algorithms FlowJo TM version 10.8.1 BD https://www.flowjo.com/solutions/flowjo/downloads ImageJ ImageJ Software https://imagej.nih.gov/ij/ GraphPad Prism v9 GraphPad Software https://www.graphpad.com/ Cell Reports 45, 116992, February 24, 2026 19 3 μL of N, N, N9, N9-tetramethylethylenediamine (TEMED; Bio-Rad) were added into the above mixed hydrogel solution. .. A 50- 70 mm-thick gel was cast, and the thickness was confirmed through imaging of embedded fluorescent beads (Invitrogen) in the gel by confocal microscope.

    Software:

    Article Title: Liquid-liquid phase separation of EphB4 drives pulmonary hypertension via YAP activation.
    Article Snippet: To polymerize the mixtures, 6 μL of 10% w/v ammonium persulfate (Bio-Rad) and .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting ANXA2, Target sequence (5’to3’): GCAGGAAATTAACAGAGTCTA Beijing Tsingke Biotech N/A siRNA targeting Ywhae (Rat), Target sequence (5’to3’): ACGAAATGGTGGAATCAATGAAG Beijing Tsingke Biotech N/A siRNA targeting Anxa2 (Rat), Target sequence (5’to3’): CCGAGTGTATAAGGAAATGTACA Beijing Tsingke Biotech N/A Recombinant DNA Plasmid containing full-length EPHB4 (human) ZOMANBIO Cat#ZK50168 Plasmid containing Cry2 (CRY2olig-mCherry) Addgene Cat#60032 Plasmid pEGFP-N1 Miaoling Biology Cat#P0133 Plasmid ECFP-TevS-YPET Addgene Cat100097 Software and algorithms FlowJo TM version 10.8.1 BD https://www.flowjo.com/solutions/flowjo/downloads ImageJ ImageJ Software https://imagej.nih.gov/ij/ GraphPad Prism v9 GraphPad Software https://www.graphpad.com/ Cell Reports 45, 116992, February 24, 2026 19 3 μL of N, N, N9, N9-tetramethylethylenediamine (TEMED; Bio-Rad) were added into the above mixed hydrogel solution. .. A 50- 70 mm-thick gel was cast, and the thickness was confirmed through imaging of embedded fluorescent beads (Invitrogen) in the gel by confocal microscope.



    Similar Products

    plasmid ecfp tevs ypet addgene  (Addgene inc)
    94
    Addgene inc plasmid ecfp tevs ypet addgene
    Plasmid Ecfp Tevs Ypet Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+ecfp+tevs+ypet+addgene/ECFP-TevS-YPET+(Plasmid+%23100097)/pm41689807-289-60-62
    Average 94 stars, based on 1 article reviews
    plasmid ecfp tevs ypet addgene - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results